1
Fork 0

Add Peter Hull's contributed translation of the fasta shootout benchmark (integer-only version).

This commit is contained in:
Graydon Hoare 2010-09-15 18:22:10 -07:00
parent e270ab6fbf
commit cd1a765c6f
3 changed files with 132 additions and 1 deletions

View file

@ -17,5 +17,6 @@ Matt Brubeck <mbrubeck@limpet.net>
Michael Bebenita <mbebenita@mozilla.com> Michael Bebenita <mbebenita@mozilla.com>
Or Brostovski <tohava@gmail.com> Or Brostovski <tohava@gmail.com>
Patrick Walton <pwalton@mozilla.com> Patrick Walton <pwalton@mozilla.com>
Peter Hull <peterhull90@gmail.com>
Ralph Giles <giles@thaumas.net> Ralph Giles <giles@thaumas.net>
Roy Frostig <rfrostig@mozilla.com> Roy Frostig <rfrostig@mozilla.com>

View file

@ -1,4 +1,7 @@
type tree = tag(nil(), node(@tree, @tree, int)); tag tree {
nil();
node(@tree, @tree, int);
}
fn item_check(&tree t) -> int { fn item_check(&tree t) -> int {
alt (t) { alt (t) {

View file

@ -0,0 +1,127 @@
/* -*- mode: rust; indent-tabs-mode: nil -*-
* Implementation of 'fasta' benchmark from
* Computer Language Benchmarks Game
* http://shootout.alioth.debian.org/
*/
use std;
import std._vec;
import std._str;
import std._uint;
import std._int;
fn LINE_LENGTH() -> uint {
ret 60u;
}
obj myrandom(mutable u32 last) {
fn next(u32 mx) -> u32 {
last = (last * 3877u32 + 29573u32) % 139968u32;
auto ans = (mx*last) / 139968u32;
ret ans;
}
}
type aminoacids = tup(char, u32);
fn make_cumulative(vec[aminoacids] aa) -> vec[aminoacids] {
let u32 cp = 0u32;
let vec[aminoacids] ans = vec();
for (aminoacids a in aa) {
cp += a._1;
ans += tup(a._0, cp);
}
ret ans;
}
fn select_random(u32 r, vec[aminoacids] genelist) -> char {
if (r < genelist.(0)._1) {
ret genelist.(0)._0;
}
fn bisect(vec[aminoacids] v, uint lo, uint hi, u32 target) -> char {
if (hi > (lo + 1u)) {
let uint mid = lo + (hi - lo) / 2u;
if (target < v.(mid)._1) {
be bisect(v, lo, mid, target);
}
else {
be bisect(v, mid, hi, target);
}
}
else {
ret v.(hi)._0;
}
}
ret bisect(genelist, 0u, _vec.len[aminoacids](genelist) - 1u, r);
}
fn make_random_fasta(str id, str desc, vec[aminoacids] genelist, int n) {
log(">" + id + " " + desc);
auto rng = myrandom(std.rand.mk_rng().next());
let str op = "";
for each (uint i in _uint.range(0u, n as uint)) {
op += select_random(rng.next(100u32), genelist) as u8;
if (_str.byte_len(op) >= LINE_LENGTH()) {
log(op);
op = "";
}
}
if (_str.byte_len(op) > 0u) {
log(op);
}
}
fn make_repeat_fasta(str id, str desc, str s, int n) {
log(">" + id + " " + desc);
let str op = "";
let uint sl = _str.byte_len(s);
for each (uint i in _uint.range(0u, n as uint)) {
op += s.(i % sl);
if (_str.byte_len(op) >= LINE_LENGTH()) {
log(op);
op = "";
}
}
if (_str.byte_len(op) > 0u) {
log(op);
}
}
fn main(vec[str] args) {
let vec[aminoacids] iub = make_cumulative(vec(tup( 'a', 27u32 ),
tup( 'c', 12u32 ),
tup( 'g', 12u32 ),
tup( 't', 27u32 ),
tup( 'B', 2u32 ),
tup( 'D', 2u32 ),
tup( 'H', 2u32 ),
tup( 'K', 2u32 ),
tup( 'M', 2u32 ),
tup( 'N', 2u32 ),
tup( 'R', 2u32 ),
tup( 'S', 2u32 ),
tup( 'V', 2u32 ),
tup( 'W', 2u32 ),
tup( 'Y', 2u32 )));
let vec[aminoacids] homosapiens = make_cumulative(vec(tup( 'a', 30u32 ),
tup( 'c', 20u32 ),
tup( 'g', 20u32 ),
tup( 't', 30u32 )));
let str alu =
"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
let int n = 512;
make_repeat_fasta ("ONE", "Homo sapiens alu", alu, n*2);
make_random_fasta("TWO", "IUB ambiguity codes", iub, n*3);
make_random_fasta ("THREE", "Homo sapiens frequency", homosapiens, n*5);
}